Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_047771 | |||
Gene | NARS | Organism | Human |
Genome Locus | Build | hg19 | |
Disease | Papillary Thyroid Carcinoma | ICD-10 | #N/A (D09.3) |
DBLink | Link to database | PMID | 30123704 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Forty PTC and matched adjacent noncancerous tissue samples |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward AAATGATCCAAGTCTCCCAG ReverseAAAGCCTTTAGACCTGTTTT | Statistics | Fold Change : Downregulated, 6.71 pvalue : 0.03596 |
Citation | |||
Ren, H, Liu, Z, Liu, S, Zhou, X, Wang, H, Xu, J, Wang, D, Yuan, G (2018). Profile and clinical implication of circular RNAs in human papillary thyroid carcinoma. PeerJ, 6:e5363. |